Kode Genetik, Resep bagi Kehidupan

Mengungkap bagaimana DNA dibaca sebagai resep untuk membuat protein. Karena fungsinya ini, DNA dinobatkan sebagai buku resep atau cetak biru (blueprint ) bagi kehidupan.

Image from scienceprogress.org

Image from scienceprogress.org

Bila bilangan biner yang hanya terdiri dari angka 0 dan 1 saja bisa membuat komputer melakukan berbagai pekerjaan, maka DNA tentunya bisa berbuat lebih hebat lagi. Sebab DNA terdiri dari 4 macam kode (A, G, T dan C) yang tidak lain melambangkan basa-basa nukleotida penyusun DNA. DNA adalah untai panjang basa-basa nukleotida, panjangnya bisa jutaan hingga miliaran basa (lihat lagi artikel tentang DNA di sini). Sekilas memang kita pusing kalau mengamati urut-urutan basa DNA, bayangkan jutaan huruf tapi cuma ada ACTG di situ. Tapi tentu saja tidak mungkin itu semua hanya timbunan huruf tanpa makna, pastilah urutan basa itu memiliki makna besar terselubung yang mesti dipecahkan.

Benar saja, ternyata memang DNA adalah blueprint atau resep untuk membuat protein, zat yang sangat berperan menunjang kehidupan makhluk hidup. Masalah ini sudah kita bahas pada tulisan “Mesin Super Canggih itu Ada dalam Tubuh Kita“.

Setelah diketahui bahwa DNA terdiri dari 4 macam basa, ilmuwan menduga-duga bagaimana caranya urut-urutan basa DNA bisa menentukan urutan asam amino penyusun protein, pasti ada keteraturan atau rumusan tertentu.

Berbagai kemungkinan sandi pun dicoba, namun akhirnya diketahui bahwa rumusan itu amat sederhana sekaligus rumit (lho, kok bisa?), mereka menyusun suatu ‘rumusan tanpa spasi’.

Jadi bayangkan DNA genom sebagai sebuah buku tebal yang terdiri atas bab-bab yang disebut kromosom. Setiap bab terdiri atas kalimat-kalimat bermakna yang diselingi iklan. Kalimat bermakna ini kita namakan gen karena dialah yang berfungsi sebagai resep untuk membuat protein, sedangkan selingan iklan adalah bagian DNA yang belum diketahui secara pasti apa fungsinya (‘junk DNA’ alias DNA sampah). Kalimat bermakna (gen) ini terdiri atas kata-kata yang memiliki jumlah huruf yang sama, yang mana masing-masing kata adalah sandi yang mewakili asam amino tertentu. Inilah kode genetik itu.

Kode Genetik

Nah yang jadi masalah berapakah jumlah huruf dalam setiap kata tersebut? Kalau 2 huruf, berarti ada 4^2 kemungkinan alias 8, padahal kita tahu ada 20 asam amino yang menyusun protein. Maka yang paling mungkin adalah 3 huruf, karena berarti ada 4^3 kemungkinan atau 64. Jadi kalau begitu satu asam amino bisa dikodekan oleh lebih dari satu kata. Kata 3 huruf ini lebih dikenal dengan nama kodon.

Kode genetik yang pertama berhasil dipecahkan adalah UUU untuk asam amino Phenylalanine (Phe/F) Menyusul kemudian kode genetik untuk ke-19 asam amino lainnya. Berikut ini adalah kode genetik untuk ke-20 asam amino. Kode genetik di bawah ini disusun berdasarkan kodon RNA (Ingat, T pada DNA berubah menjadi U pada RNA, untuk lebih jelasnya baca lagi artikel ini):

Amino Acid 3-letter code 1-letter code Codon, Genetic Code
Alanine Ala A GCU, GCC, GCA, GCG
Arginine Arg R CGU, CGC, CGA, CGG, AGA, AGG
Asparagine Asn N AAU, AAC
Aspartic acid Asp D GAU, GAC
Cysteine Cys C UGU, UGC
Glutamine Gln Q CAA, CAG
Glutamic acid Glu E GAA, GAG
Glycine Gly G GGU, GGC, GGA, GGG
Histidine His H CAU, CAC
Isoleucine Ile I AUU, AUC, AUA
Leucine Leu L UUA, UUG, CUU, CUC, CUA, CUG
Lysine Lys K AAA, AAG
Methionine Met M AUG
Phenylalanine Phe F UUU, UUC
Proline Pro P CCU, CCC, CCA, CCG
Serine Ser S UCU, UCC, UCA, UCG, AGU,AGC
Threonine Thr T ACU, ACC, ACA, ACG
Tryptophan Trp W UGG
Tyrosine Tyr Y UAU, UAC
Valine Val V GUU, GUC, GUA, GUG
Start AUG *
Stop UAG (amber), UGA (opal), UAA (ochre)

* AUG adalah start codon yang paling umum. Alternatif start codon lain misalnya CUG pada eukaryotes dan GUG pada prokaryotes.

Table di atas bisa juga disajikan dalam bentuk tabel Kodon RNA seperti ini:

First

Position

(5′ end)

Second Position

U C A G
U UUU (Phe)

UUC (Phe)

UUA (Leu)

UUG (Leu)

UCU (Ser)

UCC (Ser)

UCA (Ser)

UCG (Ser)

UAU (Tyr)

UAC (Tyr)

UAA (Stop)

UAG (Stop)

UGU (Cys)

UGC (Cys)

UGA (Stop)

UGG (Trp)

U

C

A

G

C CUU (Leu)

CUC (Leu)

CUA (Leu)

CUG (Leu)

CCU (Pro)

CCC (Pro)

CCA (Pro)

CCG (Pro)

CAU (His)

CAC (His)

CAA (Gln)

CAG (Gln)

CGU (Arg)

CGC (Arg)

CGA (Arg)

CGG (Arg)

U

C

A

G

A AUU (Ile)

AUC (Ile)

AUA (Ile)

AUG (Met/Start)

ACU (Thr)

ACC (Thr)

ACA (Thr)

ACG (Thr)

AAU (Asn)

AAC (Asn)

AAA (Lys)

AAG (Lys)

AGU (Ser)

AGC (Ser)

AGA (Arg)

AGG (Arg)

U

C

A

G

G GUU (Val)

GUC (Val)

GUA (Val)

GUG (Val)

GCU (Ala)

GCC (Ala)

GCA (Ala)

GCG (Ala)

GAU (Asp)

GAC (Asp)

GAA (Glu)

GAG (Glu)

GGU (Gly)

GGC (Gly)

GGA (Gly)

GGG (Gly)

U

C

A

G

Third

Position

(3′ end)

Yang istimewa, kode genetik ini berlaku universal, setiap makhluk hidup mulai dari virus, bakteri, jamur, serangga, mamalia termasuk manusia memiliki kode genetik yang sama. Hanya terdapat sedikit pengecualian saja.

Membaca kode genetik

Image from wikipedia.org

Image from wikipedia.org

Bagaimana resep genetik dibaca oleh tubuh kita? Ini juga tidak sederhana lho, banyak sekali aturannya. Seperti telah diungkap di atas, tidak semua bagian DNA merupakan resep genetik, pada manusia 98%-nya adalah junk DNA, hanya 2% yang berupa gen yang mengkodekan protein. Tubuh kita dan juga makhluk hidup lain sudah dibekali ‘kecerdasan’ untuk membedakan bagian DNA mana yang harus dibaca dan mana yang tidak. Yang paling sederhana adalah pada bakteri, karena sebagian besar DNA-nya adalah gen.
Ilustrasi berikut ini mungkin bisa membantu kita memahami bagaimana sel tubuh membaca resep kehidupannya sendiri. Coba perhatikan contoh urutan basa DNA berikut:

ATGTATTCTTACGGAATCCCTGAT

Sel membaca kalimat di atas sebagai kata-kata 3 huruf:

ATG TAT TCT TAC GGA ATC CCT GAT

Sesuai tabel kode genetik di atas, sel menterjemahkan kata-kata itu menjadi:

ATG TAT TCT TAC GGA ATC CCT GAT (DNA)
 M   Y   S   Y   G   I   P   D  (Asam amino)

Reading Frame

Kalau kita jeli, kita akan melihat adanya alternatif pembacaan lain. Coba perhatikan, kalimat tadi bisa juga dibaca begini:

A TGT ATT CTT ACG GAA TCC CTG AT

Atau seperti ini:

AT GTA TTC TTA CGG AAT CCC TGA T

Dan kalau diterjemahkan hasilnya pun akan berbeda:

A TGT ATT CTT ACG GAA TCC CTG AT
   C   I   L   T   E   S   L
AT GTA TTC TTA CGG AAT CCC TGA T
    V   F   L   R   N   P   *

Jadi ada 3 alternatif pembacaan dari satu utas DNA, dan karena DNA itu adalah pasangan 2 utas yang saling berkomplemen, berarti kalimat inipun bisa dibaca pada utas pasangannya, artinya total ada 6 cara pembacaan DNA, atau istilah kerennya Reading Frame.

Dari 6 Reading Frame, biasanya hanya salah satu frame saja yang merupakan kalimat bermakna alias gen, frame ini kita namakan Open Reading Frame (ORF).

Sederhana sekali sekaligus sebuah sistem yang cerdas bukan? Seperti itulah resep kehidupan kita dan seluruh makhluk hidup disusun, dibaca dan diterjemahkan. Dari kode-kode sederhana namun menghasilkan makhluk hidup yang amat rumit.

, , ,

Trackbacks/Pingbacks

  1. Regulasi dan Ekspresi Genetik | ScienceBiotech - March 26, 2010

    […] tahu bahwa setiap sel memiliki satu paket utuh DNA yang merupakan resep genetik, pada manusia paket DNA ini berupa 23 pasang kromosom. Semua resep genetik manusia ada di situ, […]

Leave a Reply